>5m64_T mol:na length:70  Template DNA
GTCTTCAACTGCTTTCGCATGAAGTACCTCCCAACTACTTTTCCTCACACTTGTACTCC
ATGACTAAACC