>5m73_A mol:na length:145  Human gene for small cytoplasmic 7SL RNA (7L30.1)
GGGUGUCCGCACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCA
GGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCG
UGCUGAUCAGUAGUGGGAUCGCGCCUA