>5npk_F mol:na length:20  DNA (5'-D(*AP*GP*CP*CP*GP*TP*AP*GP*GP*TP*AP*CP*CP*TP*AP*CP*GP*GP*CP*T)-3')
AGCCGTAGGTACCTACGGCT