>5ns3_D mol:na length:34  double-stranded RNA
XCGCACCUGACCCCAUGCCGAACUCAGAAGUGCG