>5nss_I mol:na length:63  Template promoter DNA
GAGACGGCTGGCACGACTTTTGCCAGATCAGCCCTGGGCGCGCATGCTGTTGCGCATTC
ATGT