>5o6i_I mol:na length:25  DNA (25-MER)
CGCGCCGGAACTTACCCGGCAAGGC