>5o9g_I mol:na length:208  DNA (162-MER)
ATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCC
AGGCACGTGTCAGATATATACATCGATTAACGATGCTGGGCATAAGCGTGGTTCAATAC
CGGCGCATAAAGGGTAAATTCGAAAACAGCG