>5txn_F mol:na length:21  DNA (5'-D(*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG)P*CP*GP*CP*CP*G)-3')
ACAGTCCCTGTTCGGGCGCCG