>5txn_T mol:na length:27  DNA (5'-D(*TP*GP*GP*TP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*TP*G)-3')
ATGGTCGGCGCCCGAACAGGGACTGTG