>5wc9_G mol:na length:21  DNA (5'-D(*CP*CP*AP*TP*TP*CP*AP*TP*TP*CP*AP*TP*TP*CP*AP*TP*TP*CP*GP*GP*A)-3')
CCATTCATTCATTCATTCGGA