>5x0x_J mol:na length:167  DNA (167-MER)
ATCGTACTTCTCGACAAGCTATCGGATGTATATATCTGACACGTGCCTGGAGACTAGGG
AGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGC
TAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCGAT