>5x11_J mol:na length:28  DNA (28-MER)
GTAATCATGTAACTATTTACATGTTCCG