>5xf6_I mol:na length:145  DNA (145-MER)
ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGG
CATGTTCAGCTGAATCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTT
TGGTAGTATCTGCAGGTGGATATTGAT