>5xou_C mol:na length:22  DNA (5'-D(P*TP*GP*AP*GP*GP*TP*AP*TP*GP*GP*TP*TP*GP*T)-3')
TGAGGTATGTAGGTTGTATAGT