>5y7g_E mol:na length:24  DNA (5'-D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*AP*CP*TP*T)-3')
GAATGTGTGTCTCAATCCCAACTT