>5zr1_G mol:na length:72  72bp-oring DNA, ACS305, T-rich
TGGTTTTTATATGTTTTGTTATGTATTGTTTATTTTCCCTTTAATTTTAGGATATGAAA
ACAAGAATTTATC