>6alh_A mol:na length:29  DNA (5'-D(*GP*GP*GP*CP*TP*AP*AP*TP*GP*AP*CP*GP*GP*CP*GP*AP*AP*TP*AP*CP*CP*C)-3')
GGGCTACCTCTCCATGACGGCGAATACCC