>6an8_E mol:na length:27  DNA TEMPLATE (5'- D(*AP*TP*GP*AP*AP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*TP*GP*TP*G)-3')
ATGAACGGCGCCCGAACAGGGACTGTG