>6an8_P mol:na length:21  DNA PRIMER (5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*GP*CP*GP*CP*CP*GP)-3')
ACAGTCCCTGTTCGGGCGCCG