>6asx_R mol:na length:29  RNA (29-MER)
CCUGACUAGUCUUUCAGGCGAUGUGUGCU