>6bch_O mol:na length:26  DNA (26-MER)
CAAATGCTCCTATACGACGTTTAGAC