>6bjv_D mol:na length:21  RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*UP*AP*CP*UP*UP*CP*GP*AP*UP*U)-3')
CGUACGCGGAAUACUUCGAUU