>6c0w_I mol:na length:147  147 mer DNA
ATCTGAGAATCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTA
AACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTC
CAGGCACGTGTCAGATATATACATCCGAT