>6c6s_A mol:na length:29  DNA (29-MER)
GGGCTGCGGTAGCGTGACGGCGAATACCC