>6c6u_A mol:na length:29  DNA (29-MER)
GGGCTGCGGTAGCGTGACGGCGAATACCC