>6c6u_R mol:na length:20  RNA (5'-R(*GP*CP*AP*UP*UP*CP*AP*AP*AP*GP*CP*CP*GP*AP*GP*AP*GP*GP*UP*A)-3')
GCAUUCAAAGCCGAGAGGUA