>6cg0_F mol:na length:46  DNA (46-MER)
CGGGTTTTTGTTAAGGGCTGTATCACTGTGTAAGACAGGCCAGATC