>6cg0_G mol:na length:60  DNA (60-MER)
CGGGTTTTTGTCTGGCTTCACACTTGATTTGCATCACTGTGTAAGACAGGCCAGATCCA
G