>6cg0_M mol:na length:41  DNA (41-MER)
CACAGTGATGCAAATCAAGTGTGAAGCCAGACAAAAACCCG