>6cnb_Y mol:na length:71  DNA (71-MER)
CAACTTGGCCATGGAGTCATTTTATCTTGTGTCACTTTTACAGAAAAAGTATTACTAAT
ATATGTTGAAAA