>6d6q_O mol:na length:62  DNA/RNA (62-MER)
GCGTCTTTACGGTGCTCACCACACCACACCACACCACACCACACCACACCACACAAAAA
AAA