>6dbt_F mol:na length:50  Reverse strand of 12-RSS substrate DNA
CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC