>6dbt_G mol:na length:61  Forward strand of 23-RSS substrate DNA
GATCTGGCCTGTCTTACACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACCCTGC
AG