>6dbu_E mol:na length:34  Forward strand RSS substrate DNA
GATCTGGCCTGTCTTACACAGTGCTACAGACTGG