>6dbu_F mol:na length:34  Reverse strand RSS substrate DNA
CCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC