>6dbu_H mol:na length:34  Reverse strand RSS substrate DNA
CCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC