>6dww_C mol:na length:25  DNA (25-MER)
CTTGTTGTTGTTCTCTGGTTCACGC