>6dwz_C mol:na length:26  DNA (26-MER)
CTTGTTGTTGTTCTCTGGGTCACGCG