>6esf_I mol:na length:147  DNA (147-MER)
ACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTA
AAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAAT
TGAGCGGCCTCGGCACCGGGATTCTCCAG