>6fqs_F mol:na length:20  DNA (5'-D(*GP*AP*GP*AP*GP*TP*AP*T*GP*GP*CP*CP*AP*TP*AP*CP*TP*CP*TP*T)-3')
GAGAGTATGGCCATACTCTT