>6jbq_G mol:na length:48  DNA (48-MER)
CTGCATCCGTGAGTCGAGGGTGTTCAATAATTAGCACTAAAAGTTCCG