>6jgw_C mol:na length:27  DNA (27-MER)
TTGACCCTATAGTGGCTACAGGGTGTT