>6k4y_N mol:na length:60  DNA (60-MER)
CGAAAAGAAGCTTTGCTTAATAATCCATATGGTTATAATGGGAGCTGTCACGGATGCAG
G