>6ke9_I mol:na length:145  Human telomeric DNA (145-MER)
ATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTT
AGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGT
TAGGGTTAGGGTTAGGGTTAGGGTGAT