>6ke9_J mol:na length:145  Human Telomeric DNA (145-MER)
ATCACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
CCCTAACCCTAACCCTAACCCTAAGAT