>6kqd_H mol:na length:27  DNA (5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*TP*CP*AP*CP*GP*GP*AP*TP*GP*CP*AP*GP*G*)-3')
TATAATGGGAGCTGTCACGGATGCAGG