>6ksf_C mol:na length:21  DNA (5'-D(*DGP*DGP*DAP*DTP*DCP*DCP*DAP*DGP*DCP*DAP*DCP*DGP*DCP*DCP*DAP*DCP*DTP*DCP*DAP*DGP*DC)-3')
GGATCCAGCACGCCACTCAGC