>6l49_J mol:na length:485  DNA (485-MER)
ATCGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAA
AACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATT
GAGCGGCCTCGGCACCGGGATTCTGATTATCCAGGCCGTTGGGGCCTATCCAATCGATG
TATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGG
GGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGC
CTCGGCACCGGGATTCTGATTATCCAGGCCGTCCGGGCCTATCCAATCGATGTATATAT
CTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAG
CGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCA
CCGGGATTCTGAT