>6l9h_I mol:na length:145  Human Telomeric DNA (145-MER) - G-strand
ATCTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTT
AGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGT
TAGGGTTAGGGTTAGGGTTAGGGTGAT