>6l9h_J mol:na length:145  Human Telomeric DNA (145-MER) - C-strand
ATCACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
CCCTAACCCTAACCCTAACCCTAAGAT